texas red t7 primer Search Results


dop pcr 25 reaction solution  (Cytiva Europe)
93
Cytiva Europe dop pcr 25 reaction solution
Dop Pcr 25 Reaction Solution, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/pm22831897-48-13-44?v=Cytiva+Europe
Average 93 stars, based on 1 article reviews
dop pcr 25 reaction solution - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
t7 terminator primer  (5 PRIME)
90
5 PRIME t7 terminator primer
T7 Terminator Primer, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/pmc04642736-44-106-109?v=5+PRIME
Average 90 stars, based on 1 article reviews
t7 terminator primer - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
t7 promoter primer  (5 PRIME)
90
5 PRIME t7 promoter primer
T7 Promoter Primer, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/pmc04642736-44-99-102?v=5+PRIME
Average 90 stars, based on 1 article reviews
t7 promoter primer - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
fam-labeled t7 f primer (6fam taatacgactcactataggg)  (Promega)
90
Promega fam-labeled t7 f primer (6fam taatacgactcactataggg)
Fam Labeled T7 F Primer (6fam Taatacgactcactataggg), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/us11773380-446-54-17?v=Promega
Average 90 stars, based on 1 article reviews
fam-labeled t7 f primer (6fam taatacgactcactataggg) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
universal sp6 and t7 primers  (Promega)
90
Promega universal sp6 and t7 primers
Universal Sp6 And T7 Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/pm18616587-94-34-36?v=Promega
Average 90 stars, based on 1 article reviews
universal sp6 and t7 primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
sp6 primers  (Promega)
90
Promega sp6 primers
Sp6 Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/us07138278-1323-9-16?v=Promega
Average 90 stars, based on 1 article reviews
sp6 primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
t3 primer  (Promega)
90
Promega t3 primer
T3 Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/us07223730-384-12-19?v=Promega
Average 90 stars, based on 1 article reviews
t3 primer - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
t7 primer  (Promega)
90
Promega t7 primer
T7 Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/pm09402017-316-20-22?v=Promega
Average 90 stars, based on 1 article reviews
t7 primer - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
t3, t7 primers  (Promega)
90
Promega t3, t7 primers
T3, T7 Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/10__1074_slash_jbc__272__36__22742-72-6-8?v=Promega
Average 90 stars, based on 1 article reviews
t3, t7 primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
t7 primers  (Macrogen)
86
Macrogen t7 primers
T7 Primers, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/10__1016_slash_j__nxmate__2025__101050-91-8-10?v=Macrogen
Average 86 stars, based on 1 article reviews
t7 primers - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier
internal t3 t7 primers  (Laragen Inc)
90
Laragen Inc internal t3 t7 primers
Internal T3 T7 Primers, supplied by Laragen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/pm26663587-253-17-5?v=Laragen+Inc
Average 90 stars, based on 1 article reviews
internal t3 t7 primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
t3 t7 primers  (GATC Biotech)
90
GATC Biotech t3 t7 primers
T3 T7 Primers, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/texas+red+t7+primer/pmc02894786-309-10-13?v=GATC+Biotech
Average 90 stars, based on 1 article reviews
t3 t7 primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results